View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19042_low_3 (Length: 406)
Name: NF19042_low_3
Description: NF19042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19042_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 79 - 387
Target Start/End: Complemental strand, 6144711 - 6144403
Alignment:
| Q |
79 |
tatcatttaattcatactttaggtcaatataaatatgaagttgtattcttgttttttactaaacaatttgttaagaatgattttgtgataggttaatgga |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6144711 |
tatcatttaattcatactttaggtcaatataaatatgaagttgtattcttgttttttgctaaacaatttgttaagaatgattttgtgcaaggttaatgga |
6144612 |
T |
|
| Q |
179 |
ttgctactcgatcttannnnnnnnnnnnnnnnnnnnnnnntcaatcgttttatttttggtcataagtgtgatcctttatattgtgtataattgcggtcaa |
278 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6144611 |
ttgctactcgatcttagtgtgtgtgcgtgtgtgtttgtgttcaatcattttatttttggtcataagtgtgatcctttatattgtggataattgcggtcaa |
6144512 |
T |
|
| Q |
279 |
atgtggctaatgtggcctcaattgcagttgtggatacatcaaaaaccttaatgtcgcagctcagattgcaatcatggacttttttaaccttgtgtttgcc |
378 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6144511 |
atttggctaatgtggcctcaattgcagttgtggatacatcaaaaaacttaatgtcgcagctcagattgcaatcatggacttttttaaccttgtgtttgcc |
6144412 |
T |
|
| Q |
379 |
tacaatctg |
387 |
Q |
| |
|
||||||||| |
|
|
| T |
6144411 |
tacaatctg |
6144403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 28182845 - 28182901
Alignment:
| Q |
288 |
atgtggcctcaattgcagttgtggatacatcaaaaaccttaatgtcgcagctcagat |
344 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| | ||||| ||||||||| |
|
|
| T |
28182845 |
atgtggcctcaattgcagttggagagacatcaaaaaccatgatgtcatagctcagat |
28182901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 273 - 309
Target Start/End: Original strand, 6041148 - 6041184
Alignment:
| Q |
273 |
ggtcaaatgtggctaatgtggcctcaattgcagttgt |
309 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6041148 |
ggtcaaatgtggctggtgtggcctcaattgcagttgt |
6041184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University