View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19043_low_13 (Length: 275)
Name: NF19043_low_13
Description: NF19043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19043_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 181 - 251
Target Start/End: Original strand, 6629525 - 6629595
Alignment:
| Q |
181 |
ctgtgggagtagaaaattgaagaaattcgtttaaaaaccatcttcaattccttttctcttaagactttcgt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6629525 |
ctgtgggagtagaaaattgaagaaattcgtttaaaaaccatcttcaattccttttctcttaagactttcgt |
6629595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 6629370 - 6629430
Alignment:
| Q |
25 |
ggatatagacgggcacgaattcccgtctcaatgctaattaatgtacattattaccaaaatg |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6629370 |
ggatatagacgggcacgaattcccgtctcaatgctaattaatgtacattattaccaaaatg |
6629430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University