View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19043_low_25 (Length: 216)
Name: NF19043_low_25
Description: NF19043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19043_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 23 - 201
Target Start/End: Original strand, 6608506 - 6608684
Alignment:
| Q |
23 |
ttgaggctagtgatactatagctattggtcctatggtgatagttactattgtcaataaggtagaagctccaactccaaaaactataactgttgattgcaa |
122 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
6608506 |
ttgaggctagtgataccatagctattggtcctatggtgatagttactatagtcaataaggtacaggctccaactccaacaactataactgttcattgcaa |
6608605 |
T |
|
| Q |
123 |
atccaataatgttgatcatggatctcgcacaattggttttggagatatttacctgattacattccaaccagaatattct |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6608606 |
atccaataatgttgatcatgcatctcgcacaattggttttggagatatttacctaattacattccaaccagaattttct |
6608684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 90 - 155
Target Start/End: Original strand, 31121296 - 31121361
Alignment:
| Q |
90 |
tccaactccaaaaactataactgttgattgcaaatccaataatgttgatcatggatctcgcacaat |
155 |
Q |
| |
|
||||||||||| ||| || |||||| ||||||||||||| |||| ||||| ||||| || |||||| |
|
|
| T |
31121296 |
tccaactccaacaaccatgactgttcattgcaaatccaaaaatgatgatcttggatttcacacaat |
31121361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University