View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19043_low_9 (Length: 345)

Name: NF19043_low_9
Description: NF19043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19043_low_9
NF19043_low_9
[»] chr3 (3 HSPs)
chr3 (167-337)||(50368665-50368835)
chr3 (19-90)||(50368912-50368983)
chr3 (167-286)||(50378878-50378998)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 167 - 337
Target Start/End: Complemental strand, 50368835 - 50368665
Alignment:
167 aagatggctccggttattggtaagatattgactcaacttgtggtggatggggaaactaatgaggttgacttgaaacattttaggattggaagattccaaa 266  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50368835 aagatggctccagttattggtaagatattgactcaacttgtggtggatggggaaactaatgaggttgacttgaaacattttaggattggaagattccaaa 50368736  T
267 tggcatctaagatttaggtaggtgtctatccttatgtatgtgttctgtcatgtgtgtttgtaattcatctc 337  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50368735 tggcatctaagatttaggtaggtgtctatccttatgtatgtgttctgtcatgtgtgtttgtaattcatctc 50368665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 50368983 - 50368912
Alignment:
19 tggtggggttgttgattcaagtgagccggtggtgaaacaatcttgcatgtattcaatgacaccagatgagga 90  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
50368983 tggtggggttgttgattcaagtgagccagtggtgaaacaatcttgcatgtattcaatgacaccagatgagga 50368912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 167 - 286
Target Start/End: Complemental strand, 50378998 - 50378878
Alignment:
167 aagatggctccggttattggtaagatattgactcaacttgtggtggatggggaaactaatgaggttgacttgaaacattttaggattggaagattccaaa 266  Q
    ||||||||||| |||||||| ||||| |||||  | ||||||||||| |||| ||||||||||||||| |||||||| |||||||||||||||||| |||    
50378998 aagatggctcctgttattgggaagattttgaccgagcttgtggtggacgggggaactaatgaggttgatttgaaacactttaggattggaagattcaaaa 50378899  T
267 -tggcatctaagatttaggta 286  Q
     || | |||||| ||||||||    
50378898 gtgacttctaagctttaggta 50378878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University