View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19043_low_9 (Length: 345)
Name: NF19043_low_9
Description: NF19043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19043_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 167 - 337
Target Start/End: Complemental strand, 50368835 - 50368665
Alignment:
| Q |
167 |
aagatggctccggttattggtaagatattgactcaacttgtggtggatggggaaactaatgaggttgacttgaaacattttaggattggaagattccaaa |
266 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50368835 |
aagatggctccagttattggtaagatattgactcaacttgtggtggatggggaaactaatgaggttgacttgaaacattttaggattggaagattccaaa |
50368736 |
T |
 |
| Q |
267 |
tggcatctaagatttaggtaggtgtctatccttatgtatgtgttctgtcatgtgtgtttgtaattcatctc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50368735 |
tggcatctaagatttaggtaggtgtctatccttatgtatgtgttctgtcatgtgtgtttgtaattcatctc |
50368665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 19 - 90
Target Start/End: Complemental strand, 50368983 - 50368912
Alignment:
| Q |
19 |
tggtggggttgttgattcaagtgagccggtggtgaaacaatcttgcatgtattcaatgacaccagatgagga |
90 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50368983 |
tggtggggttgttgattcaagtgagccagtggtgaaacaatcttgcatgtattcaatgacaccagatgagga |
50368912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 167 - 286
Target Start/End: Complemental strand, 50378998 - 50378878
Alignment:
| Q |
167 |
aagatggctccggttattggtaagatattgactcaacttgtggtggatggggaaactaatgaggttgacttgaaacattttaggattggaagattccaaa |
266 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||| | ||||||||||| |||| ||||||||||||||| |||||||| |||||||||||||||||| ||| |
|
|
| T |
50378998 |
aagatggctcctgttattgggaagattttgaccgagcttgtggtggacgggggaactaatgaggttgatttgaaacactttaggattggaagattcaaaa |
50378899 |
T |
 |
| Q |
267 |
-tggcatctaagatttaggta |
286 |
Q |
| |
|
|| | |||||| |||||||| |
|
|
| T |
50378898 |
gtgacttctaagctttaggta |
50378878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University