View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19044_high_4 (Length: 426)
Name: NF19044_high_4
Description: NF19044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19044_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 11 - 408
Target Start/End: Original strand, 44910807 - 44911204
Alignment:
| Q |
11 |
cacagaggtctacatgaagagaaaataaacctgtattacattgtcctcttttacacctatgcaatatgtacggatattttgctagtttttctcagaatta |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910807 |
cacagaggtctacataaagagaaaataaacctgtattacattatcctcttttacacctatgcaatatgtacggatattttgctagtttttctcagaatta |
44910906 |
T |
 |
| Q |
111 |
ggcttcagattctttctcttattggacctgggaacggtttctcctcgaatctagaaggactagctgaatgtctgatgactggcaagttttccaaagtcgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910907 |
ggcttcagattctttctcttattggacctgggaacggtttctcctcgaatctagaaggactagctgaatgtctgatgactggcaagttttccaaagtcgt |
44911006 |
T |
 |
| Q |
211 |
caaaacctcagacatttgtggtctaaatttggcctcactaatacattgtaacgcaagaattgcagctgtataagccgccctttgtggatactgcccttgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911007 |
caaaacctcagacatttgtggtctaaatttggcctcactaatacattgtaacgcaagaattgcagctgtataagccgccctttgtggatactgcccttgt |
44911106 |
T |
 |
| Q |
311 |
aatcttgtgtccataatccgaaacaactttcttctatcacccaagtatggtcttgcccaatctaccagattatgttccgctcctgattttgttttatc |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44911107 |
aatcttgtgtccataatccgaaacaactttcttctatcacccaagtatggtcttgcccaatctaccagattatgttccgctcctgattttgttttatc |
44911204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University