View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19044_low_6 (Length: 372)
Name: NF19044_low_6
Description: NF19044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19044_low_6 |
 | |
|
| [»] scaffold0242 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 72 - 355
Target Start/End: Complemental strand, 6912390 - 6912107
Alignment:
| Q |
72 |
gtttattgatcgaaaataaacatccaatttgtttaaattcagttggtttaaatttgccaatttcttatgaagaatatgattgttgcatcagtagatattt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912390 |
gtttattgatcgaaaataaacatccaatttgtttaaattcagttggtttaaatttgccaatttcttatgaagaatatgattgttgcatcagtagatattt |
6912291 |
T |
|
| Q |
172 |
ctttaacatccaaactagaatttatttggtaaaccaaacaaatgcacttgaatatgcaagtatatggtcactctttgttttgtaagagttcaatgttctg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912290 |
ctttaacatccaaactagaatttatttggtaaaccaaacaaatgcacttgaatatgcaagtatatggtcactctttgttttgtaagagttcaatgttctg |
6912191 |
T |
|
| Q |
272 |
ctattgcaatggttgacannnnnnnnccttataacattgcagggaaccaatgctgtgatgcagtgagaattgagcctgagtact |
355 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912190 |
ctattgcaatggttgacattttttttccttataacattgcagggaaccaatgctgtgatgcagtgagaattgagcctgagtact |
6912107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 14 - 57
Target Start/End: Complemental strand, 6912515 - 6912472
Alignment:
| Q |
14 |
tactggtatgacacatgctattacaggggaactttgtattcatg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912515 |
tactggtatgacacatgctattacaggggaactttgtattcatg |
6912472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 299 - 355
Target Start/End: Complemental strand, 15717 - 15661
Alignment:
| Q |
299 |
cttataacattgcagggaaccaatgctgtgatgcagtgagaattgagcctgagtact |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15717 |
cttataacattgcagggaaccaatgctgtgatgcaatgagaattgagcctgagtact |
15661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 299 - 355
Target Start/End: Complemental strand, 24552 - 24496
Alignment:
| Q |
299 |
cttataacattgcagggaaccaatgctgtgatgcagtgagaattgagcctgagtact |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24552 |
cttataacattgcagggaaccaatgctgtgatgcaatgagaattgagcctgagtact |
24496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University