View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_29 (Length: 293)
Name: NF19045_high_29
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 9e-39; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 40 - 125
Target Start/End: Original strand, 30260655 - 30260740
Alignment:
| Q |
40 |
ctattggttggcgggaagccgagagcaaaaacggagcaatactccaaaattacaagagagatgtaacatctctattcaaattcttc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30260655 |
ctattggttggcgggaagccgagagcaaaaacggagcaatactccaaaattacaagagagatgtaacatctctatccaaattcttc |
30260740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 209 - 293
Target Start/End: Original strand, 30260778 - 30260862
Alignment:
| Q |
209 |
acatgttaaccatttataggcgatgtgaaacttaatcactcacatttaaaatccaacaatctcatctttaaatatgaatttttac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||| |||| |||||||| ||||||| |
|
|
| T |
30260778 |
acatgttaaccatttataggcgatgtgagacttaatcactcatatttaaaattcaacaatctcgtcttcaaatatgagtttttac |
30260862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 285
Target Start/End: Complemental strand, 29447921 - 29447850
Alignment:
| Q |
214 |
ttaaccatttataggcgatgtgaaacttaatcactcacatttaaaatccaacaatctcatctttaaatatga |
285 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||| |||||| | |||| |||||||||| ||||||||||| |
|
|
| T |
29447921 |
ttaacaatttataggtgatgtgagacttaatcagtcacatatgaaattcaacaatctctcttttaaatatga |
29447850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University