View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_32 (Length: 284)
Name: NF19045_high_32
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 26 - 249
Target Start/End: Complemental strand, 28917525 - 28917301
Alignment:
| Q |
26 |
taacacctctaaccattttctaagttcaaacggtttcaaaatccatcacacaactattgaggtaatacatgttgctatttcgannnnnnnnnnnnacttt |
125 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28917525 |
taacaactctaaccattttctaagtccaaacggtttcaaaatccatcacacaactattgaggtaatacatgttgctatttcgatttttcttttttacttg |
28917426 |
T |
 |
| Q |
126 |
cttgatttcgtcttgaactttcatcaagtttctattagtattttatataa-ttaaaattttaaatgttgaaatttagagaacaaacttttctcgtattat |
224 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28917425 |
cttgatttcgtcttgaacttccatcaagtttatattagtattttatataagttaaaattttaaatgttgaaatttagagaacaaagttttctcgtattat |
28917326 |
T |
 |
| Q |
225 |
attatcttgctaataaggacaacaa |
249 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
28917325 |
attatcttgctagtaaggacaacaa |
28917301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University