View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_36 (Length: 266)
Name: NF19045_high_36
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 115 - 256
Target Start/End: Original strand, 40300901 - 40301036
Alignment:
| Q |
115 |
gcaatttttaagtcacgtggaattgaataggcaacaaaactctctttcaaaacctatttaagaaaatttaaggcttttatgtatgcatggttatggttag |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40300901 |
gcaattcttaagtcacgtggaattgaataagcaacaaaactctctttcaaaacctatttaagaaaatttaaggcttttatgtatgc------atggttag |
40300994 |
T |
|
| Q |
215 |
gttactccaaacatattgttaaattgaataagactcgttcat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
40300995 |
gttactccaaacatattgttaaattgaacaagactagttcat |
40301036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 40300803 - 40300837
Alignment:
| Q |
17 |
actatatagtaaacatggatctatgaaggtataac |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40300803 |
actatatagtaaacatggatctatgaaggtataac |
40300837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University