View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_39 (Length: 250)
Name: NF19045_high_39
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 29932668 - 29932430
Alignment:
| Q |
1 |
caaccatgccaacctgcgttgcctcggtaatagctacgtaaaacttactccctccttctcatataataagtgttacattt-gatgtatttcactgtctca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29932668 |
caaccatgccaacctgcgttgcctcggtaatagctacgtaaaacttactccctccttctcatataataagtgttacattttgatgtatttcactgtctca |
29932569 |
T |
|
| Q |
100 |
tatcatttgtcattttagaatatatcaaatattactcttgttagattcaacttagattgatcnnnnnnnncttaattttcctagaatgttgcaaaattta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29932568 |
tatcatttgtcattttagaatatatcaaatattactcttgttagattcaacttagattgatcttttttttcttaattttcctagaatgttacaaaattta |
29932469 |
T |
|
| Q |
200 |
gagcggacgggataggatcagtatgtgggaggttatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29932468 |
gagcggacgggataggatcagtatgtgggaggttatatt |
29932430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University