View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_46 (Length: 227)
Name: NF19045_high_46
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_46 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 42 - 227
Target Start/End: Complemental strand, 29282311 - 29282126
Alignment:
| Q |
42 |
ggggcatttcaccgtcgaagatgatatccaattcatctttaaattgtgcggctctaggtttttcaattggttgttgatggatttcaccttttcagcattt |
141 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29282311 |
ggggcatttcgccgtcgaagatgatatccaattcatctttaaattgtgcggctctaggtttttcaattagttgttgatggatttcaccttttcagcattt |
29282212 |
T |
 |
| Q |
142 |
tttattattgtctnnnnnnntannnnnnnnnattactcttattttgtttttatcgtgtgcatcaaacacatgatatgataaattgt |
227 |
Q |
| |
|
|||||||||||| || ||||||||||| || ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29282211 |
tttattattgtccaaaaaaatatttttttttattactcttatcttatttttatcgtgtgcatcaaacacataatatgataaattgt |
29282126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 220
Target Start/End: Complemental strand, 21748254 - 21748222
Alignment:
| Q |
188 |
tttttatcgtgtgcatcaaacacatgatatgat |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
21748254 |
tttttatcatgtgcatcaaacacatgatatgat |
21748222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 84
Target Start/End: Complemental strand, 31382710 - 31382670
Alignment:
| Q |
44 |
ggcatttcaccgtcgaagatgatatccaattcatctttaaa |
84 |
Q |
| |
|
|||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
31382710 |
ggcatttctccatcaaagatgatatccaattcatctttaaa |
31382670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University