View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_49 (Length: 216)
Name: NF19045_high_49
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 24436544 - 24436365
Alignment:
| Q |
19 |
ttaaccatagtttgtgtgctttatgcatgtctttgccaagtttctctcctttgctcacacaaaacaacttcaccttcagaggaagagtggaacggttcag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24436544 |
ttaaccatagtttgtgtgctttatgcatgtcttggccaagtttctctcctttgctcacacaaaacaacttcaccttcagaggaagagtggaacggttcag |
24436445 |
T |
|
| Q |
119 |
atcctatctaacatctcagatgtaaattttgcgaatagagatgtgaggtggatcccacacgctcttagggtatggtacat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24436444 |
atcctatctaacatctcagatgtaaattttgcgaatagagatgtgaggtggatcccacacgctgttagggtatggtacat |
24436365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University