View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_high_52 (Length: 211)
Name: NF19045_high_52
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 744588 - 744763
Alignment:
| Q |
18 |
gaagcttgattaaaacttaaatttattattagcatcattgacaaaataaatttgcccaaatacaaagttttgggacagttaatacaaaataaaactataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
744588 |
gaagcttgattaaaacttaaatttattattagcatcattgacaaaataaatttgcccaaatacaaagttttgggacagttaatacaaaataaaactataa |
744687 |
T |
|
| Q |
118 |
atatataagccatatgtttcccccaattggagttggtttggactatgtaacaatgtaaatcctttctatatatatc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
744688 |
atatataagccatatgtttcccccaattggagttggtttggactatgtaacaatgtaaatcctttctatatatatc |
744763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University