View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_low_15 (Length: 392)
Name: NF19045_low_15
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_low_15 |
 |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
| [»] scaffold2117 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 16497531 - 16497158
Alignment:
| Q |
1 |
ttccagaacaatgtctctatttcaagagcattgttactgtttttcttcttcttgttcatgtaacttttttcaaaccatttggctttgatttcaaactcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16497531 |
ttccagaacaatgtctctatttcaagagcattgttactgtttttctttttcttgttcatgtaacttttttcaaaccatttggctttgatttcaaactcag |
16497432 |
T |
 |
| Q |
101 |
agaaagtgtagtggtccccaccctaccaaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatc |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16497431 |
agaaagtgtagtggtccccactctaccaaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttggaagcttggtttttgatc |
16497332 |
T |
 |
| Q |
201 |
ttgaaaatgtattcgattggatcttcgaattcagctggagtgggttggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16497331 |
ttgaaaatgtattcgattggatcttcgaattcagctggagtgggttggtattcgggtgctactggcatggattttaaccatgggaatacatcaccgtttg |
16497232 |
T |
 |
| Q |
301 |
attttggtgatagaaagttctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16497231 |
attttggtgatagaaagttctttttggagttgatgggttttgatgatccgattttgaatgatggtggtggtgtt |
16497158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 40779082 - 40778720
Alignment:
| Q |
1 |
ttccagaacaatgtctctatttcaagagcattgttactgtttttcttcttcttgttcatgtaacttttttcaaaccatttggctttgatttcaaactcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | || | ||||||||||||||||||||||||| |
|
|
| T |
40779082 |
ttccagaacaatgtctctatttcaagagcactgttactgtttttcttcttcttgttcatat-------tt--atccatttggctttgatttcaaactcat |
40778992 |
T |
 |
| Q |
101 |
agaaagtgtagtggtccccaccctaccaaacgggtcgtttaacgggggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatc |
200 |
Q |
| |
|
| ||||||||||||||| || |||||||| |||||||||||| ||||||||||||||||||||||||||||| | |||||| |||||||||||| |||| |
|
|
| T |
40778991 |
a--aagtgtagtggtcccaactctaccaaatgggtcgtttaacaggggaaaaggagggatgattttgcagattccgaatttggaagcttggttttcgatc |
40778894 |
T |
 |
| Q |
201 |
ttgaaaatgtattcgattggatcttcgaattcagctggagtgggttggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttg |
300 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40778893 |
tttaaaatgtattcgattggatcttcgaattcagctggagtgggttggtattcgggtgctactggcatggattttaaccatgggaatacatcaccgtttg |
40778794 |
T |
 |
| Q |
301 |
attttggtgatagaaagttctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40778793 |
attttggtgatagatagttctttttggagttaatgggttttggtgatccgattttgaatgatggtggtggtgtt |
40778720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 300 - 374
Target Start/End: Original strand, 49619519 - 49619594
Alignment:
| Q |
300 |
gattttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
49619519 |
gattttggtgaaagaaagtttcgttttggagttaatgggttttggtgatctgattttgaatgatggtggtggtgtt |
49619594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 34224123 - 34224268
Alignment:
| Q |
1 |
ttccagaacaatgtctctatttcaagagcattgttactgtttttcttcttcttgttcatgtaacttttttcaaaccatttggctttgatttcaaactcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||| |||||| ||||||||||| |
|
|
| T |
34224123 |
ttccagaacaatgtctctatttcaagagcactgttactgtttttcttcttcttgttcatgtaacttctttcgaaccattttgctttggcttcaaactcag |
34224222 |
T |
 |
| Q |
101 |
agaaagtgtagtggtccccaccctaccaaacgggtcgtttaacggg |
146 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
34224223 |
agaaagtgtagtggtccccactctgccaaacgggtcgtttaacggg |
34224268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 147 - 303
Target Start/End: Original strand, 34224375 - 34224531
Alignment:
| Q |
147 |
ggaaaaggagggatgattttgcagatttcaaatttgaaagcttggtttttgatcttgaaaatgtattcgattggatcttcgaattcagctggagtgggtt |
246 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||| |||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34224375 |
ggaaaaggagggataattttgcagattccgaatttggaagcttcgttttcgatcttgaaaatgtatgcgattggatcttcgaattcagctggagtgggtc |
34224474 |
T |
 |
| Q |
247 |
ggtattcgggtgctactggcatgaattttaaccatgggaatacatcaccgtttgatt |
303 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
34224475 |
ggtattcgggagctactggcatggattttaaccatgggaatacgtcgccgtttgatt |
34224531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 301 - 374
Target Start/End: Complemental strand, 36627330 - 36627256
Alignment:
| Q |
301 |
attttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| ||||| |||||| |||||| |||||||| |||||||| |
|
|
| T |
36627330 |
attttggtgaatgaaagtttctttttggagttaatggcttttggtgatccaattttggatgatggttgtggtgtt |
36627256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 318 - 374
Target Start/End: Complemental strand, 98442 - 98386
Alignment:
| Q |
318 |
ttctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
98442 |
ttctttttggagttaatgggttttggtgatccgattttgaatgatggtggtggtgtt |
98386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 374
Target Start/End: Complemental strand, 29657419 - 29657337
Alignment:
| Q |
300 |
gattttggtgatagaaagtt-ctttttggagttaatgggttttg-------atgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29657419 |
gattttggtgatagaaagtttctttttggagttaatgagttttggactttgatgatccgattttgaatgatggtggtggtgtt |
29657337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 374
Target Start/End: Original strand, 7147577 - 7147651
Alignment:
| Q |
301 |
attttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |||||| |||||| |||||||| |||||||| |
|
|
| T |
7147577 |
attttggtgaatgaaagtttctttttggagttaatgggtttcagtgatccaattttggatgatggttgtggtgtt |
7147651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 377
Target Start/End: Original strand, 37642256 - 37642311
Alignment:
| Q |
322 |
ttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgttgat |
377 |
Q |
| |
|
||||||||| ||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37642256 |
ttttggagtgaatgggtgttgatgatccaattttgaatgatggtggtggtgttgat |
37642311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 318 - 374
Target Start/End: Original strand, 28967 - 29023
Alignment:
| Q |
318 |
ttctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
||||||||||||| ||||||||||| |||||| |||||| |||||||| |||||||| |
|
|
| T |
28967 |
ttctttttggagtgaatgggttttggtgatccaattttggatgatggttgtggtgtt |
29023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2117 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold2117
Description:
Target: scaffold2117; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 302 - 374
Target Start/End: Original strand, 220 - 293
Alignment:
| Q |
302 |
ttttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
||||||||| | |||||| ||||||||||| |||| |||||| |||||| |||||| |||||||| |||||||| |
|
|
| T |
220 |
ttttggtgagaaaaagtttctttttggagtgaatgagttttggtgatccaattttggatgatggttgtggtgtt |
293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 337 - 374
Target Start/End: Original strand, 12365767 - 12365804
Alignment:
| Q |
337 |
gttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12365767 |
gttttggtgatccgattttgaatgatggtggtggtgtt |
12365804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 374
Target Start/End: Complemental strand, 682676 - 682602
Alignment:
| Q |
300 |
gattttggtgatagaaagtt-ctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||| || |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
682676 |
gattttggtgagagaaaatttctttttggagttagcggattttcgtgatcc-attttgaatgatggtggtggtgtt |
682602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 318 - 377
Target Start/End: Complemental strand, 14356839 - 14356780
Alignment:
| Q |
318 |
ttctttttggagttaatgggttttgatgatccgattttgaatgatggtggtggtgttgat |
377 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||| ||||||| ||||| || ||||||||||| |
|
|
| T |
14356839 |
ttctttttggagtgaatgggtgttgttgatctgattttggatgattgttgtggtgttgat |
14356780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 374
Target Start/End: Original strand, 14357570 - 14357653
Alignment:
| Q |
299 |
tgattttggtgatagaaagtt-ctttttggagttaatgggt-------tttgatgatccgattttgaatgatggtggtggtgtt |
374 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| || |||||||||| |||||||||||||| || ||||||| |
|
|
| T |
14357570 |
tgattttggtgataaaaagtttctttttggagttaatgagttttggactttgatgatctgattttgaatgatgttgatggtgtt |
14357653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University