View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_low_17 (Length: 373)
Name: NF19045_low_17
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 42 - 282
Target Start/End: Complemental strand, 29282090 - 29281853
Alignment:
| Q |
42 |
atcctaaatttatagtgttggacacctccatcttttgagaaataaagatgatctaaaccttgattgttgatattaaaggcatgtgtgtgtgagcaagatt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29282090 |
atcctaaatttatagtgttggacacctccatcttttgagaaataaa-----------ccctgattgttgatattaaaggcatgtgtgggtgagcaagatt |
29282002 |
T |
|
| Q |
142 |
tgtgattggagttgaacagggctatgaaagtaacaacgattttagtgtcatcgaatcatacttgagagttcca--------agtgttatttattactatc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
29282001 |
tgtgattggagttgaacagggctatgaaagtaacaacgattttagtgtcatcgaatcatacttgagagtccaaggattgttagtgttatttattactatc |
29281902 |
T |
|
| Q |
234 |
ctttttctctttcagccgccatatataacacacccttgtatctcatgta |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281901 |
ctttttctctttcagccgccatatataacacacccttgtatctcatgta |
29281853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 328 - 357
Target Start/End: Complemental strand, 29281807 - 29281778
Alignment:
| Q |
328 |
atagtatctagcaagaacaagatagaaaat |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29281807 |
atagtatctagcaagaacaagatagaaaat |
29281778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University