View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_low_24 (Length: 325)
Name: NF19045_low_24
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 53 - 303
Target Start/End: Complemental strand, 122042 - 121792
Alignment:
| Q |
53 |
tgtataatcgctaacaaaattttataatggaaaacaaatataaaaagttgtataactctactacaaaatcaattaactgtgaggctccacagtagatgtt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
122042 |
tgtataatcgctaacaaaattttataatggaaaacaaatataaaaagttgtataactctactacaaaatcaattaactgtgaggctccacagtagatgtt |
121943 |
T |
 |
| Q |
153 |
ctaatatgttgtataatctagcacctactacatcatctgcctaaaatcaggtcccatatgttggtgaatcaagtaatcatcattattggacatatcaaac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
121942 |
ctaatatgttgtataatctagcacctactacatcatctgcctaaaatcaggtcccatatgttggtgaatcaagtaatcatcattattggacatatcaaac |
121843 |
T |
 |
| Q |
253 |
atcatactctgatgttgtaaaatctggctttgttggtgttggtgtgcccgc |
303 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
121842 |
atcatactctgatgttgtaaaatctggttttgttggtgttggtgtgcccgc |
121792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University