View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19045_low_33 (Length: 288)

Name: NF19045_low_33
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19045_low_33
NF19045_low_33
[»] chr3 (1 HSPs)
chr3 (72-125)||(41982792-41982845)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 72 - 125
Target Start/End: Complemental strand, 41982845 - 41982792
Alignment:
72 cataaaattcattcagatgtttattatattaagattcttgttacaatattgatt 125  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
41982845 cataaaattcattcagatgtttattatattaagattcatgttacaatattgatt 41982792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University