View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_low_38 (Length: 266)
Name: NF19045_low_38
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 8288201 - 8288450
Alignment:
| Q |
1 |
atttagttcatgaaattttaatggttgataattcaatcttaaatttgaaaaacaaatgacaaaatgactcataaaattggaatttttgtcacattaatat |
100 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
8288201 |
atttagttcatgaaattgtaatagttgataattcaatcttaaatttgaaaaacaaatgacaaaataactcataaaattggaatttttgtcatattaatat |
8288300 |
T |
 |
| Q |
101 |
cttctagatgtagggtatagaagaggggtgatagtgtgaaaaagagaggggagaagaagaaggaatgctgtggaactctaacttatgacacgaggtccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288301 |
cttctagatgtagggtatagaagaggggtgatagtgtgaaaaagagaggggagaagaagaaggaatgctgtggaactctaacttatgacacgaggtccac |
8288400 |
T |
 |
| Q |
201 |
gatttggatgtttgttgtcacattaaaacatacactttagaagttttatg |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8288401 |
gatttggatgtttgttgtcacatcaaaacatacactttagaagttttatg |
8288450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University