View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19045_low_45 (Length: 248)
Name: NF19045_low_45
Description: NF19045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19045_low_45 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 6523538 - 6523309
Alignment:
| Q |
18 |
gttggctgtgtaggtaccggttacgttgttaggattacagaaatagtggaagttttgtgttgtgttatcggctttggctaactgtgatgatgaaaaaatt |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6523538 |
gttggctgtgtaggtaccagttacgttgttaggattacagaaatagtggaagttttgtgttgtgttatcagctttggctaactgtgatgatgaaaaaatt |
6523439 |
T |
 |
| Q |
118 |
attattaggagaaagattgaataatgaaaagaatctagcctcaaggaaataatagccatattggttgttctttgaatcatgagcttctatgtttgcaatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6523438 |
attattaggagaaagattgaataatgaaaagaatctagcctcaaggaaataatagccatattggttgttctttgaatcatgagcttctatg-ttgcaatg |
6523340 |
T |
 |
| Q |
218 |
atcaagggcttgtaaaaaatacgtaagacat |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
6523339 |
atcaagggcttgtaaaaaatacctaagacat |
6523309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University