View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_high_17 (Length: 266)
Name: NF19046_high_17
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 45 - 258
Target Start/End: Complemental strand, 4390580 - 4390367
Alignment:
| Q |
45 |
ttctataattccaaacattgttcttctttacggttaattcagctaattcagtgattgttaattgaccccacaagacatggcagaataagatgactgaact |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
4390580 |
ttctataattccaaacattgtccttctttgcggttaactcagctaattcagtgattgttaattgaccccacaagacatggcagaataagatgattgaatt |
4390481 |
T |
 |
| Q |
145 |
gtcgtattattctgcttgagatctagaatgcccatctccaactaatactactttgcgtaattagacttgacatacaagccttttaaatgatcccgaaaca |
244 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4390480 |
gtcgtgttattctgcttaagatctagaatgccgatctccaactaatactactttgcataattagacttgccatacaagccttttaaatgatccctaaaca |
4390381 |
T |
 |
| Q |
245 |
tccttagtattatc |
258 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4390380 |
tccttagtattatc |
4390367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University