View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_high_26 (Length: 242)
Name: NF19046_high_26
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 7724724 - 7724933
Alignment:
| Q |
19 |
tttttgtctttctttccaacataacataattaggatctttgatcccagataggtatcccaagttatccccacaacttaagtcgtttcggcctgctttgac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724724 |
tttttgtctttctttccaacataacataattaggatctttgatcccagataggtatcccaagttatccccacaacttaagtcgtttcggcctgctttgag |
7724823 |
T |
 |
| Q |
119 |
actatcctccagtcgataatgaaacatatgannnnnnnaccagagttggctacctcccacatgggtgattccacaaatcaaaccttagttcttttcttgg |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7724824 |
actatcctcaagtcgataatgaaacatatgatttttttaccagagttggctacctcccacatgggtgattccacaaattaaaccttagttcttttcttgg |
7724923 |
T |
 |
| Q |
219 |
ggagaataat |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
7724924 |
ggagaataat |
7724933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University