View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_high_36 (Length: 209)
Name: NF19046_high_36
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 200
Target Start/End: Original strand, 24543713 - 24543890
Alignment:
| Q |
23 |
aagaggaagattcaattcaagatggagaagatgagctacaacattatttattctcttcccaaggaagagaagatttgagtagtactgttttatctgaagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24543713 |
aagaggaagattcaattcaagatggagaagatgagctacaacattatttattctcttcccaaggaagagaagatttgagtagtactgttttatctgaagt |
24543812 |
T |
 |
| Q |
123 |
tgctattcttccatgcagtcatatattccacgagacatgtttatctgctttgcccctaactactatctctgctcctcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
24543813 |
tgctattcttccatgcagtcatatattccacgagacatgtttatctgctttgcccctaactactatcactgatcctcc |
24543890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University