View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_13 (Length: 322)
Name: NF19046_low_13
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 102 - 299
Target Start/End: Original strand, 25608888 - 25609067
Alignment:
| Q |
102 |
gctaacatattatacaaattctttctttgatttctgtcctttgagcccttcaggttaatcttaatcttggataccttcaggttttctcatattaattgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| | || |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25608888 |
gctaacatattatacaaattctttctatgatttctgtcctt-gagt------gtgtattcttaatcttggataccttcagattttctcatattaattgat |
25608980 |
T |
|
| Q |
202 |
taacttcccctttgagcccttccccttcaatctcaatatctaaattgattttcactttgtaagtcggtgagaaagatttcattcatatgactcagtcg |
299 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
25608981 |
taacttcccctttgagccc-----------tctcttaatctaaattgattttcactttgtaagtcagtgagaaagatttcattcatatcactcagtcg |
25609067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 25608755 - 25608858
Alignment:
| Q |
1 |
tgtgtgttcttttcttttatctaaattattttccttttgttgaacacatgatgacttacttgatactgtttgcctctgcttgtttgatttttccaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||| || |||||||||||||| |||||||||| || ||||||||||||||||| ||||||| |
|
|
| T |
25608755 |
tgtgtgttcttttcttttatctaaattattatccttctgttgtactcatgatgacttactcgatactgttttccgctgcttgtttgattttt-caatatt |
25608853 |
T |
|
| Q |
101 |
tgcta |
105 |
Q |
| |
|
||||| |
|
|
| T |
25608854 |
tgcta |
25608858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University