View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_21 (Length: 262)
Name: NF19046_low_21
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 45587627 - 45587869
Alignment:
| Q |
10 |
gcataggcttggcatcactaatgactgaggcttttaatagcagtcgagaagtttgtcttctaacatgcatttgcatgctttttgaatgcaattaataaat |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45587627 |
gcataggcttggcatcactaatgacagaggcttttaatagcagtcgagaagtttgtcttctaacatgcatttgcatgcttttt-aatgcaattaataaat |
45587725 |
T |
 |
| Q |
110 |
catttaaaaaaccgaataa-----cattaactaattaattgctggtatactttgattagggttgggggaaaacggtgataattggggtggaaatgcacgg |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587726 |
catttaaaaaaccgaataacataacattaactaattaatggttggtatactttgattagggttgggggaaaacggtgataattggggtggaaatgcacgg |
45587825 |
T |
 |
| Q |
205 |
ttcgccattgactttaaatccttatgacattttgaaaggcaaaa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45587826 |
ttcgccattgactttaaatccttatgacattttaaaaggcaaaa |
45587869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University