View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_25 (Length: 252)
Name: NF19046_low_25
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 23 - 226
Target Start/End: Complemental strand, 34709565 - 34709362
Alignment:
| Q |
23 |
gtccaattcctactttatgccaaccgagaacatgtgaacatcccccatgttgccgcgactctccacctgcttatttgaagccctaatactttgcagcgtt |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34709565 |
gtccaattcctactgtatgccaaccgagaacatgtgaacatcccccatgttgccgcgactctccacctgcttatttgaagccctaatactttgcagcgtt |
34709466 |
T |
 |
| Q |
123 |
tttgttgtgataaaaccaatcatttatagtttggaaaagtctatctgatatgtaataatttcattaataagattggttaaattattatattttcttattc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34709465 |
tttgttgtgataaaaccaatcatttatagtttagaaaagtctatctgatatgtaataatttcattaataagattggttaaattattatattttcttattc |
34709366 |
T |
 |
| Q |
223 |
tcta |
226 |
Q |
| |
|
|||| |
|
|
| T |
34709365 |
tcta |
34709362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 34697851 - 34697807
Alignment:
| Q |
156 |
gaaaagtctatctgatatgtaataatttcattaataagattggtt |
200 |
Q |
| |
|
||||||||||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
34697851 |
gaaaagtctatctcatacctaataattacattaataagattggtt |
34697807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 272028 - 272075
Alignment:
| Q |
171 |
tatgtaataatttcattaataagattggttaaattattatattttctta |
219 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
272028 |
tatgtaataattacattaataaaattggttaaa-aattatattttctta |
272075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University