View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_26 (Length: 249)
Name: NF19046_low_26
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 19641192 - 19640954
Alignment:
| Q |
1 |
tacaacgatcttggtttttagaattttgcaggtgataaaagttaaatatatgatagcaaattttaacgtgacctatctagctatcatataacagatttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
19641192 |
tacaacgatcttggtttttagaattttgcaggtgataaaagttaaatatattatagcaaattttaacatgacctagctagctatcatataacaaatttct |
19641093 |
T |
|
| Q |
101 |
atttttaccttctcgaaaagaataagcaattgaagcaattcgtgtgtttgttatatacgatcacaggcaaatcgaccgggactgtgagcttctggaacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641092 |
atttttaccttctcgaaaagaataagaaattgaaccatgtcatgtgtttgttatatatgatcacaggcaaatcgaccgggactgtgagcttctggaacag |
19640993 |
T |
|
| Q |
201 |
gagggaattatggactatagtctactagttggcattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19640992 |
gagggaattatggactatagtctactagttggcattcat |
19640954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 239
Target Start/End: Original strand, 35259167 - 35259223
Alignment:
| Q |
183 |
tgtgagcttctggaacaggagggaattatggactatagtctactagttggcattcat |
239 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
35259167 |
tgtgagcttctagaacaagagggaattatggactatagtctgctacttggcattcat |
35259223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University