View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_33 (Length: 230)
Name: NF19046_low_33
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 10 - 212
Target Start/End: Complemental strand, 4264500 - 4264296
Alignment:
| Q |
10 |
tactcaaccctgtcaattttttataaatgtgta--gagtgttgtgcacannnnnnnagttttgacatgtttttgcgaccgatttataaaccgattcaatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264500 |
tactcaaccctgtcaattttttataaatgtgtatagagtgttgtgcacatttttttagttttgacatgtttttgcgaccgatttataaaccgattcaatg |
4264401 |
T |
 |
| Q |
108 |
agacagtatacaacannnnnnnnnccggtgaaacctagacattccattactttggctctttgcataaaatacaaaatctgagtggttattaacctgtttt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4264400 |
agacagtatacaacatttttttttccggtgaaacctagacattccattactttggctctttgcataaaatacataatctgagtggttattaacctgtttt |
4264301 |
T |
 |
| Q |
208 |
agagg |
212 |
Q |
| |
|
||||| |
|
|
| T |
4264300 |
agagg |
4264296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University