View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_38 (Length: 217)
Name: NF19046_low_38
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 37490558 - 37490746
Alignment:
| Q |
16 |
aaaggaagaaaagagtaattcactaccaggttctttgaaacaaaaagatatttgtacaaaatctacacaaattattttattcggtagaaagaagaaacaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37490558 |
aaaggaagaaaagagtaattcactaccaggttctttgaaacaaaaagatatttgtacaaaatccacacaaattattttattcggtagaaagaagaaacaa |
37490657 |
T |
|
| Q |
116 |
cattagccatcggaaaactcacacatgtaagtggaatatttttgtc-------ataagactcatagtagtcaatcttagatatcagtgc |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
37490658 |
cattagccatcagaaaactcacacatataagtggaatatttttgtcagttgagataagactcgtagtagtcaatcttggatatcagtgc |
37490746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University