View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_40 (Length: 216)
Name: NF19046_low_40
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_40 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 52164831 - 52164617
Alignment:
| Q |
1 |
atgcaatccaacccaaaaccaccattcctattcttatatctcatcctattgtttttctttctaccttctttatcatctaccatcacccatcaattcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
52164831 |
atgcaatccaacccaaaaccaccatttctattcttatatctcatccttttttttttctttctaccatgtttatcatctaccatcacccatcaattcaaag |
52164732 |
T |
|
| Q |
101 |
aagctcctgaattctacaattccccgaaatgcccttccattaccgacacttcaaaatcaacagtagtccaagtagcaatgacactcgacacaacatatat |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52164731 |
aagctcctgaattctacaattccccaaaatgcccttccattaccgacacttcaaaatcaacagtagtccaagtagcaatgacactcgacacaacatatat |
52164632 |
T |
|
| Q |
201 |
ccgaggatccatggc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52164631 |
ccgaggatccatggc |
52164617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 6635775 - 6635724
Alignment:
| Q |
165 |
agtccaagtagcaatgacactcgacacaacatatatccgaggatccatggct |
216 |
Q |
| |
|
|||||| || ||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
6635775 |
agtccatgtggcaatgacattagacacaacatatatccgaggatccatggct |
6635724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University