View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19046_low_9 (Length: 368)
Name: NF19046_low_9
Description: NF19046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19046_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 175 - 339
Target Start/End: Original strand, 1759538 - 1759706
Alignment:
| Q |
175 |
tgttgatcatgtgtaataatgcttgtgattttgcttcattatttttgttgcttgagagttgtgggcagtgatttcaagtgtat-tggttttggtgttgtg |
273 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||||||||||||||| ||||||| ||||| |||||||||| |||||| | ||||||| |||||||| |
|
|
| T |
1759538 |
tgttaatcatgtgtaataatgcatgtaattttgcttcattatttttgtttcttgagacttgtgtgcagtgatttgaagtgtgtctggttttagtgttgtg |
1759637 |
T |
|
| Q |
274 |
tttgaagcggaagttcaattctaagattggaattggctt---ttgcaattattgattttattagaagtt |
339 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| ||| ||||||| ||||||||| || |||||| |
|
|
| T |
1759638 |
tttgaagtcaaagttcagttctaagattggaattgacttttgttgcaatcattgattttcttggaagtt |
1759706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 266 - 317
Target Start/End: Original strand, 1759898 - 1759949
Alignment:
| Q |
266 |
gtgttgtgtttgaagcggaagttcaattctaagattggaattggcttttgca |
317 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
1759898 |
gtgttgtatttgaagtggaagttcagttctaaggttggaattggcttttgca |
1759949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 274 - 354
Target Start/End: Complemental strand, 5156621 - 5156541
Alignment:
| Q |
274 |
tttgaagcggaagttcaattctaagattggaattggcttttgcaattattgattttattagaagttcaatatgtatctgtg |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||| ||||||| ||||||||||||| |||||||| ||| |||| |
|
|
| T |
5156621 |
tttgaagcggaagttcaattctaagattggaactgactttttcaattatcgattttattagaacttcaatatatatttgtg |
5156541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 5156717 - 5156662
Alignment:
| Q |
100 |
gaatcactttgttaataactagactctttactttgtgattgaatcactttgatttt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5156717 |
gaatcactttgttaataactagactctttagtttgtgattgaatcactttgatttt |
5156662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University