View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19047_high_15 (Length: 241)
Name: NF19047_high_15
Description: NF19047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19047_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 33705259 - 33705056
Alignment:
| Q |
1 |
tttcaagtagtacaatccaaaagcaagctggacatcaaaattaaactagtatccatatcatcatattcataccaatatctcggtttgaagctccttggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33705259 |
tttcaagtagtacaatccaaaagcaagctagacatcaaaattaaactagtatccatatcatcatattcataccaatatctcggtttgaagctccttggag |
33705160 |
T |
 |
| Q |
101 |
gcttcttcgaagaaacaaaatagaatttcattgaaggcttttgagacagtttatccgcagaagcatttaaatggatcaatgcccctgtttagataaacaa |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
33705159 |
gcttcatcgaagaaacaaaatagaatttcattgaaggcttttgtgacggtttatccgcagaagcatttaaatggatcaatg-ccctgtttggataaacag |
33705061 |
T |
 |
| Q |
201 |
tttat |
205 |
Q |
| |
|
||||| |
|
|
| T |
33705060 |
tttat |
33705056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University