View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19047_high_16 (Length: 231)
Name: NF19047_high_16
Description: NF19047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19047_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 27562394 - 27562234
Alignment:
| Q |
15 |
gcagagagagccatgggtttgtctgtgttgaagaattcaattgaggaagccagggttttgttttttgcgatttctttccttctgtcattcatttgtcgat |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27562394 |
gcagagagagccatggttttgtctgtgttgaagaattcaattgaggaagccaaggttttattttttgcgatttctttccttctgtcattcatttgtcgat |
27562295 |
T |
|
| Q |
115 |
tctgtatgagatatatgcttcgctgatgtcatagatagtgaatgctgatcgtctttctgag |
175 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27562294 |
tctgtctgagatatatgcttggctgatgtcatagatagtgaattctgatcgtctttctgag |
27562234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 36669449 - 36669288
Alignment:
| Q |
15 |
gcagagagagccatgggtttgtctgtgttgaagaattcaattgaggaagccagggttttgttttttgcgatttctttccttctgtcattcatttgtcgat |
114 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||| | |||||| ||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
36669449 |
gcagagagagctatgggtttgtctgagttgaagaattcaattgaggaagtgaaggttttattttt-gtgatttctttccttctgtcattcatttgtcgat |
36669351 |
T |
|
| Q |
115 |
tct--gtatgagatatatgcttcgctgatgtcatagatagtgaatgctgatcgtctttctgag |
175 |
Q |
| |
|
||| || | |||| ||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36669350 |
tctctgtctaagatttatgcttggctgatatcatagatagtgaatgctgatcgtctttctgag |
36669288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 27562186 - 27562145
Alignment:
| Q |
174 |
agaacttcaggtttgtaaatttgagctatctgcaatgatttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27562186 |
agaacttcaggtttgtaaatttgagctatctgcaatgatttt |
27562145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 36669239 - 36669199
Alignment:
| Q |
175 |
gaacttcaggtttgtaaatttgagctatctgcaatgatttt |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
36669239 |
gaacttcaggtttgtaaatttgaactatctgcaatggtttt |
36669199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 15 - 171
Target Start/End: Complemental strand, 26928930 - 26928772
Alignment:
| Q |
15 |
gcagagagagccatgggtttgtctgtgttgaagaattcaattgaggaagccagggttttgttttttgcgatttctttccttctgtcattcatttgtcgat |
114 |
Q |
| |
|
|||||||||||||| |||||| | ||||| ||||||||||||||||||| |||||| ||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
26928930 |
gcagagagagccattactttgtccgacttgaaaaattcaattgaggaagccaaggttttattttttgtgatttctttccttctctcattcatttgtcgat |
26928831 |
T |
|
| Q |
115 |
--tctgtatgagatatatgcttcgctgatgtcatagatagtgaatgctgatcgtctttc |
171 |
Q |
| |
|
||||| | |||||||||||| |||||||||| |||||||||||| |||||||||||| |
|
|
| T |
26928830 |
tctctgtctaagatatatgcttggctgatgtcacagatagtgaatgatgatcgtctttc |
26928772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 29411938 - 29411773
Alignment:
| Q |
15 |
gcagagagagccatgggtttgtctgtgttgaagaattcaattgaggaagccagggttttgttttttgcgattt-ctttccttctgtcattcattt--gtc |
111 |
Q |
| |
|
||||| || |||||||||||||| | ||||||| | |||||||||||||||| ||||| |||||| ||||| ||||||||| ||||||||| ||| |
|
|
| T |
29411938 |
gcagatagggccatgggtttgtccgagttgaagcactcaattgaggaagccaaggtttaactttttgtgattttctttccttccaccattcatttttgtc |
29411839 |
T |
|
| Q |
112 |
gattct--gtatgagatatatgcttcgctgatgtcatagatagtgaatgctgatcgtctttctgag |
175 |
Q |
| |
|
|||||| || | |||| |||| || ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29411838 |
gattctttgtctaagatgtatgtttggctgatgtcatagatcgtgaatgctgatcgtctttctgag |
29411773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 29411725 - 29411689
Alignment:
| Q |
174 |
agaacttcaggtttgtaaatttgagctatctgcaatg |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29411725 |
agaacttcaggtttgtcaatttgagctatctgcaatg |
29411689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University