View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19047_low_10 (Length: 265)
Name: NF19047_low_10
Description: NF19047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19047_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 66 - 178
Target Start/End: Original strand, 29237914 - 29238026
Alignment:
| Q |
66 |
ttaagacaaactctcaatccgctacgtcgagttttggattgagatttggaaggaatttgattttgtaggacaatgcatgtatgcagtatgcttaaagaat |
165 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29237914 |
ttaagacaaactctcaatccgctatgtccagttttggattgagatttggaaggaatttgattttgtaggacaatgcatgtatgcagtatgcttaaagaat |
29238013 |
T |
|
| Q |
166 |
aataagacaaagt |
178 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29238014 |
aataagacaaagt |
29238026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 193 - 265
Target Start/End: Original strand, 29237999 - 29238071
Alignment:
| Q |
193 |
gtatgcttaaagaacaataagacaaagtggctgcaagaagtatgaaacaaaaatggatctggaaatttatact |
265 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29237999 |
gtatgcttaaagaataataagacaaagtggctgcaagaagtatgaaacaaaaatggatctggaaatttatact |
29238071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 67
Target Start/End: Original strand, 29237823 - 29237879
Alignment:
| Q |
11 |
cacagaccacagtgtttatataatcaatctacagtgttatctcctaacgttactttt |
67 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
29237823 |
cacagaccacagtttttacataatcaacctacagcgttatcccctaacgttactttt |
29237879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University