View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19047_low_14 (Length: 254)
Name: NF19047_low_14
Description: NF19047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19047_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 37 - 254
Target Start/End: Complemental strand, 33705880 - 33705662
Alignment:
| Q |
37 |
aataatggttgagtggtgaaggcttggaacctagatgtatgctctctctaggtttcaaatataaattctactcgtgccaataatttatgtgttagattgg |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
33705880 |
aataatggttgagtggtgaaggcttggaacctagatgtatgctctctctaggtctcaaatataaattctactggtgccaacaatttatgtgttagattgg |
33705781 |
T |
 |
| Q |
137 |
tctatacatatctttactatagttttaagtggtccctcgttaatagacggtgaaattgattctctata-nnnnnnngaagaagattagtcggcctttagg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33705780 |
tctatacatatctttactatagttttaagtggtccctcattaatagacggtgaaattgattctctatattttttttgaagaagattagtcggcctttagg |
33705681 |
T |
 |
| Q |
236 |
ccaaatgtataatattttt |
254 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
33705680 |
ccaaattcctaatattttt |
33705662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University