View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_high_18 (Length: 293)
Name: NF1904_high_18
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 54 - 207
Target Start/End: Complemental strand, 38038683 - 38038530
Alignment:
| Q |
54 |
taagttcatatgcattggagggccatttatattcctctttttcaatttcatttcttgtcaataatcatgaaatacaagtatccgacttcgaatttacttc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38038683 |
taagttcatatgcattggagggccatttatattcctctttttcaatttcatttcttgtcaataatcatgaaatacaagtatccgacttcgaatttactcc |
38038584 |
T |
 |
| Q |
154 |
ctcaaacaacatgtatcaattgcacaattaacagcataagaacagaacagaaca |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038583 |
ctcaaacagcatgtatcaattgcacaattaacagcataagaacagaacagaaca |
38038530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University