View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_high_26 (Length: 234)
Name: NF1904_high_26
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 7144664 - 7144870
Alignment:
| Q |
14 |
gcataggcgctttctaggatgcgcgagcccctcatgtcgtgcatcgtgcgcgaatgaaaattatgctagtgtata-tacatgcgtctatattatgagtgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
7144664 |
gcataggcgctttctaggatgcgcgagcccctcatgtcgtgcatggtgcgcgaacgaaaatcatgctagtgtatactacatgcgtctgcattatgagtaa |
7144763 |
T |
 |
| Q |
113 |
tgctatatttaacgagagatttactcgcgaaagaatcacgataaaatctaggcaattaaatttcgtaatttagcataaaacacgaagcctcattgaaaag |
212 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||| | | ||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
7144764 |
tgctatattcagcgagagatttactcgcgaaagaatcacgataaaacccatgcaattaaatttcgttatttagcagaaaacacgaagcctcattgaaaag |
7144863 |
T |
 |
| Q |
213 |
tacaagt |
219 |
Q |
| |
|
||||||| |
|
|
| T |
7144864 |
tacaagt |
7144870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University