View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_high_27 (Length: 223)
Name: NF1904_high_27
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 23665487 - 23665286
Alignment:
| Q |
1 |
tgcaatcacacaattgaaacatcaacatcatcaattcatgatcacgannnnnnnnaatgtaataaaataatgaatttaaaatttaaatcgtctaatcttg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23665487 |
tgcaatcacacagttgaaacatcaacattatcaattcatgatcacgattttttttaatgtaataaaataatgaatttaaaatctaaatcgtctaatcttg |
23665388 |
T |
 |
| Q |
101 |
gtataatacctaacgatgtgcggaatgtgtgaatagatacctccacaccttgctactctcacgttcgtcattgttatgtagcaattatgttctatgtctg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23665387 |
gtataatacctaacgatatgcggaatgtgtgaatgga---atccacaccttgctactctcacgttcgtcattgttatgtagcaattatgttctatgtctg |
23665291 |
T |
 |
| Q |
201 |
aattt |
205 |
Q |
| |
|
||||| |
|
|
| T |
23665290 |
aattt |
23665286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University