View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_low_12 (Length: 387)
Name: NF1904_low_12
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 20 - 376
Target Start/End: Complemental strand, 13674087 - 13673731
Alignment:
| Q |
20 |
aattgcttcctcgcccttcagtagttgcgcaacctttagtacagaaagaaacaaatcacgttccagacacaaacacatgtgtttacatttaatcaccttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13674087 |
aattgcttcctcgcccttcagtagttgcgcaacctttagtacagaaagaaacaaatcacgttccagacacaaacacatgtgtttacatgtaatcaccttt |
13673988 |
T |
 |
| Q |
120 |
gcttacgtaaattattattagtgtaagtattgtgtccaatgtatgtgtcagcgcttcatagaaaaggatgcttattttcttacttgtttcatgaatggcc |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13673987 |
gcttacttaaattattattagtgtaagtattgtgtccaatgtatgtgtcagcgcttcatagaaaaggatgcttattttcttacttgtttcatgaatggcc |
13673888 |
T |
 |
| Q |
220 |
gcttggaggatgaatggtggacgcacaaggaagctgtcttcatggcacggttcatttcggtgggatcatatttctcttctaatctaggatctgctagctc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13673887 |
gcttggaggatgaatggtggacgcacaaggaagctgtcttcatggcacggttcatttcggtgggatcatatttctcttctaatctaggatctgctagctc |
13673788 |
T |
 |
| Q |
320 |
ttggacattttttgagtcaagaagtggcttggcctgacaatagtagatcatgttcat |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13673787 |
ttggacattttttgagtcaagaagtggcttggcctgacaatagtagatcatgttcat |
13673731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University