View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_low_16 (Length: 353)
Name: NF1904_low_16
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 13 - 338
Target Start/End: Original strand, 5382003 - 5382330
Alignment:
| Q |
13 |
aatattctcataactcatgattttgaacctctggtaagttagttctctgccttctttttggcaataaaaaataccattacttcactattgcatatt-cat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5382003 |
aatattctcataactcatgattttgaacctctggtacgttagttctctgccttctttttggcaataaaaaataccattacttcactattgcatatttcat |
5382102 |
T |
 |
| Q |
112 |
ctgtctatatatctttcaatnnnnnnnnnn-tcaattaatttaagtggatgtggacatactttaagtttacttaccaaaagacgaaggccgtgaatctga |
210 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5382103 |
ctgtctatatatctttcaataaaaataaaaataaattaatttaagtggatgtggacatactttaagtttacttaccaaaagacgaaggccgtgaatctga |
5382202 |
T |
 |
| Q |
211 |
agtgtgtttcgaggtgcatcaaatgtgcacttcattttctaacagtattgaattgtgctaaaatatgcaaggttggtgattttggactggcaaggtggca |
310 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5382203 |
agtgtgtttccaggtgcatcaaatgtgcacttcattttctaacagtaatgaattgtgctaaaatatgcaaggttggtgattttggactggcaaggtggca |
5382302 |
T |
 |
| Q |
311 |
acctgatggagacatgggtgtggatact |
338 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5382303 |
acctgatggagacatgggtgtggatact |
5382330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 288 - 334
Target Start/End: Complemental strand, 42744017 - 42743971
Alignment:
| Q |
288 |
gattttggactggcaaggtggcaacctgatggagacatgggtgtgga |
334 |
Q |
| |
|
||||||||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
42744017 |
gattttggacttgctaggtggcagccagatggagacatgggtgtgga |
42743971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 278 - 324
Target Start/End: Complemental strand, 43071549 - 43071503
Alignment:
| Q |
278 |
caaggttggtgattttggactggcaaggtggcaacctgatggagaca |
324 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
43071549 |
caaggttggtgattttggacttgcaaggtggcagcctgatggagaca |
43071503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University