View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_low_28 (Length: 247)
Name: NF1904_low_28
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_low_28 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 81 - 247
Target Start/End: Original strand, 33378299 - 33378466
Alignment:
| Q |
81 |
gtgcctaggcgacctgaatgtctatattcaaataccttgggtagcctattttgtttcaaagcacatgatatgaagatactacgatgattttatagaggtt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
33378299 |
gtgcctaggcgacctgaatgtctatattcaaataccttgggtagcttattttgtttcaaagcacatgatatgaagatactacagtgattttatagagatt |
33378398 |
T |
 |
| Q |
181 |
gatatcagttaaatgtttttatatctctcactctcaaatgtcagttaaatattgtctc-tgctcctcc |
247 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
33378399 |
gatatcagttaaatatttttatatctctcactctcaaaaatcagttaaatattgtctcttgctcctcc |
33378466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 33377311 - 33377398
Alignment:
| Q |
1 |
tttgattgaaaccgataacattaaagagaacatggagtaagatgccactttggcacatcccaaaattgttgattccatgggtgcctag |
88 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33377311 |
tttgattgaaaccgattacattaaagagaacatggagtaagatgccactttggcacatcccaaaattgttgattccatgggtgcctag |
33377398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 19754234 - 19754169
Alignment:
| Q |
9 |
aaaccgataacattaaagagaacatggagtaagatgccactttggcacatcccaaaattgttgatt |
74 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
19754234 |
aaacagattacattaaagagaacatggagtaagctgccactttggcacatcccaaaattattgatt |
19754169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 86 - 148
Target Start/End: Complemental strand, 19753295 - 19753234
Alignment:
| Q |
86 |
taggcgacctgaatgtctatattcaaataccttgggtagcctattttgtttcaaagcacatga |
148 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
19753295 |
taggcaacctgaaggtctaaattcaaataccttgggt-gcctattttgtttcatagcacatga |
19753234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 160
Target Start/End: Complemental strand, 19753236 - 19753172
Alignment:
| Q |
95 |
tgaatgtctatattcaaataccttgggtagcctattttgtttcaaagcacatgatatgaagatact |
160 |
Q |
| |
|
|||| ||||| ||||||||||| ||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
19753236 |
tgaaggtctaaattcaaataccatgggt-gcctattttgtttcatagcacatgatatgaaaatact |
19753172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 207
Target Start/End: Complemental strand, 19753146 - 19753107
Alignment:
| Q |
168 |
ttttatagaggttgatatcagttaaatgtttttatatctc |
207 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
19753146 |
ttttatagaggttgatatgagttaaacgtttttatatctc |
19753107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 16513698 - 16513733
Alignment:
| Q |
18 |
acattaaagagaacatggagtaagatgccactttgg |
53 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16513698 |
acattgaagagaacatggagtaagatgccactttgg |
16513733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University