View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1904_low_38 (Length: 210)
Name: NF1904_low_38
Description: NF1904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1904_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 6292116 - 6292308
Alignment:
| Q |
1 |
gaaatctctagcatgatgtaccaatttttgaacttcttgcaaacaacaaaagcacctttttggatcaatgcttacccttactttgcatataaagatgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6292116 |
gaaatctctagcatgatgtaccaatttttgaacttcttgcaaacaacaaaagcacctttttggatcaatgcttacccttactttgcatataaagatgatc |
6292215 |
T |
 |
| Q |
101 |
cagattcaattcctttggactatgttttatttaatcctagtcaaggaatggttgatcctaccacaaatctacattatgataacatgctttatg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6292216 |
cagattcaattcctttggactatgttttatttaatcctagtcaaggaatggttgatcctaccacaaatctacattatgataacatgctttatg |
6292308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 23 - 193
Target Start/End: Complemental strand, 32856688 - 32856518
Alignment:
| Q |
23 |
aatttttgaacttcttgcaaacaacaaaagcacctttttggatcaatgcttacccttactttgcatataaagatgatccagattcaattcctttggacta |
122 |
Q |
| |
|
||||||||||||| ||| || ||||||| |||| |||||| |||||||||| ||||| ||||| ||||| |||| || || ||| |||| ||||| |
|
|
| T |
32856688 |
aatttttgaactttttgtcaaaaacaaaatcacccttttgggtcaatgcttatccttattttgcttataagaatgaccctaatcaaatatctttagacta |
32856589 |
T |
 |
| Q |
123 |
tgttttatttaatcctagtcaaggaatggttgatcctaccacaaatctacattatgataacatgctttatg |
193 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
32856588 |
tgtattatttaatcctaaccaaggaatggttgatcctaatacaaatttacattatgataacatgctttatg |
32856518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University