View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_23 (Length: 403)
Name: NF19050_high_23
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 14 - 298
Target Start/End: Original strand, 48393246 - 48393540
Alignment:
| Q |
14 |
tttattttctt-ggctccgagaagctgaacattacaagcaggcatgtttgcataatcgattgggtgatgtcacgaataataaaataatttcattttcaat |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48393246 |
tttattttctttggctccgagaagctgaacattacaagcaggcatgtttgcataatcgattgggtgatgtcacgaataataa-----tttcattttcaat |
48393340 |
T |
 |
| Q |
113 |
gtcaacaactagcaaa--attctg----------agacatctgaactcgcttcctcctccattttgcgtacaata-----tccatgtatgtatctcagcg |
195 |
Q |
| |
|
|||||| || |||| ||| || | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
48393341 |
gtcaac---taacaaagcattgtggatatataataaacatctgaactcgcttcctcctccattttgcgtacaatataatatccatgtatgtatctctgcg |
48393437 |
T |
 |
| Q |
196 |
aattggaaatacaatccaaatcttcatccatgtctgcagcagcttcgagatcatgatcaggaattgcagcctccttatcagatagaaaagtagcattgtc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393438 |
aattggaaatacaatccaaatcttcatccatgtctgcagcagcttcgagatcatgatcaggaattgcagcctccttatcagatagaaaagtagcattgtc |
48393537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 362 - 398
Target Start/End: Original strand, 48393539 - 48393575
Alignment:
| Q |
362 |
ataatcacattatgaatttcatttttatattcttcga |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |
|
|
| T |
48393539 |
ataatcacattatgaatttcatttttatttttttcga |
48393575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 64
Target Start/End: Original strand, 13857449 - 13857502
Alignment:
| Q |
11 |
agatttattttcttggctccgagaagctgaacattacaagcaggcatgtttgca |
64 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
13857449 |
agattttttttcttggctcctagaagctgaacattacaggcaggcatctttgca |
13857502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University