View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_25 (Length: 354)
Name: NF19050_high_25
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 270 - 345
Target Start/End: Complemental strand, 4015886 - 4015811
Alignment:
| Q |
270 |
gatgatgactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgggatct |
345 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4015886 |
gatgaagactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgagatct |
4015811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 335
Target Start/End: Complemental strand, 4017701 - 4017639
Alignment:
| Q |
273 |
gatgactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttcc |
335 |
Q |
| |
|
||||||||||||||| ||| ||||| |||| || |||||| | ||||||||||| |||||||| |
|
|
| T |
4017701 |
gatgactctgtcaccggcggtcctctccgaggatctcatcgtcgaggtactttcgtttcttcc |
4017639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University