View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_34 (Length: 305)
Name: NF19050_high_34
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 24 - 289
Target Start/End: Original strand, 50589323 - 50589588
Alignment:
| Q |
24 |
tttcatattttgatttgttatcaataactataaccgaatataaaaagcattcgaaccaatttggtttctttgtaattgtaatttctgttgtttgagaaat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
50589323 |
tttcatattttgatttgttatcaataactataaccgaatagaaaaagcattcgaaccaatttggtttctttgtaattgtaatttctgttgtt-gataaat |
50589421 |
T |
 |
| Q |
124 |
cctaatgtattagaattagttatggcttgaccttctaatgaattttagttagtttcttaagtattcaatccttctttgcttcgtctgttaatgttatgct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50589422 |
cctaatgtattagaattagttatggcttgaccttctaatgaattttagttaggttcttaagtattcaatccttctttgcttcgtctgttaatgttatgct |
50589521 |
T |
 |
| Q |
224 |
taaacctgcatttc-ttttttgattatctctttgtacaagtttaacagcttgtttgattagatgaaa |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50589522 |
taaacctgcatttctttttttgattatctctttgtacaagtttaacagctcgtttgattagatgaaa |
50589588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University