View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_37 (Length: 286)
Name: NF19050_high_37
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 276
Target Start/End: Original strand, 56378570 - 56378838
Alignment:
| Q |
17 |
acattcttccttctagagctgtagcgccacctcatggacatggccacatcatcatgccattcaactacaacataccttctgaatctgatgaacaagaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378570 |
acattcttccttctagagctgtagcgccacctcatggacatggccacatcatcatgccattcaactacaacataccttctgaatctgatgaacaagaaga |
56378669 |
T |
|
| Q |
117 |
ggcagcaggtagactacatatgcatc---------atcaacagcagcagcagcaggaggtagtgatgaagaaaaggttcaggacaaaattcacacaggaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378670 |
ggcagcaggtagactacatatgcatcatcatcatcatcaacagcagcagcagcaggaggtagtgatgaagaaaaggttcaggacaaaattcacacaggaa |
56378769 |
T |
|
| Q |
208 |
cagaaggagaaaatgttgaactttgctgagaaagttggatggaaatttcaaaagcaagaggaatctgtg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378770 |
cagaaggagaaaatgttgaactttgctgagaaagttggatggaaatttcaaaagcaagaggaatctgtg |
56378838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 184 - 251
Target Start/End: Complemental strand, 2494418 - 2494351
Alignment:
| Q |
184 |
ttcaggacaaaattcacacaggaacagaaggagaaaatgttgaactttgctgagaaagttggatggaa |
251 |
Q |
| |
|
||||||||||| || ||||| || |||||||| || ||| |||| ||||||||||||||||| ||||| |
|
|
| T |
2494418 |
ttcaggacaaagtttacacaagatcagaaggataagatgctgaaatttgctgagaaagttgggtggaa |
2494351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 240
Target Start/End: Complemental strand, 14021574 - 14021521
Alignment:
| Q |
187 |
aggacaaaattcacacaggaacagaaggagaaaatgttgaactttgctgagaaa |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||| || |||||| | || ||||||||| |
|
|
| T |
14021574 |
aggacaaaattcacgcaggaacagaaggataagatgttggagttagctgagaaa |
14021521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University