View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_39 (Length: 282)
Name: NF19050_high_39
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 67 - 266
Target Start/End: Original strand, 27781648 - 27781845
Alignment:
| Q |
67 |
tagtagtggcagtaactaaaaggaatgattagtacaatcattaattaatttgtaaaatcaccatgtattatcatatatcaaaattcatctgtgcatcaaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
27781648 |
tagtagtggcagtaactaaaaggaatgattagtacgatgattaattaatttgtaaaatcaccatgtattaccatatatcaaaattcatctg--catcaaa |
27781745 |
T |
 |
| Q |
167 |
ataactttctggtatggtatccctggctttcaagacggcaaaactaaagtgaatggagaagaagaaaggaaaattaaaccatcatcgctagtccttgatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27781746 |
ataactttctggtatggtatccctggctttcaagacggcaaaactaaagtgaatggagaagaagaaaggaaaattaaaccatcatcgctagtccttgatg |
27781845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 24414446 - 24414402
Alignment:
| Q |
24 |
atactttccgctttgtgatctgttaagcgattttgatgactaata |
68 |
Q |
| |
|
||||||||| ||||||||||||||||| | ||||||||||||||| |
|
|
| T |
24414446 |
atactttcccctttgtgatctgttaagtggttttgatgactaata |
24414402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University