View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_5 (Length: 580)
Name: NF19050_high_5
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 6e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 457 - 578
Target Start/End: Original strand, 10799765 - 10799886
Alignment:
| Q |
457 |
tcttggatcaatcttggaacaatatggcagaagatgaggcatcagaacaaagattattgaaacagattgaagcagaacctcatgagaaatttcaagattc |
556 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10799765 |
tcttggatcaatcttggaacaatatggcagaagatgaggcagcagaacaaagattattgaaacagattgaagcagaacctcatgagaaatttcaagattc |
10799864 |
T |
 |
| Q |
557 |
gagaggaaatcttcaccctaat |
578 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10799865 |
gagaggaaatcttcaccctaat |
10799886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University