View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_high_50 (Length: 243)
Name: NF19050_high_50
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 29 - 228
Target Start/End: Complemental strand, 24400848 - 24400649
Alignment:
| Q |
29 |
aataggaatttaggaatattagtttgtgaaaggtagggtgttaaatatttacaagttttcttcgtcaattgagccaccataaaccacagattcttgaacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400848 |
aataggaatttaggaatattagtttgtgaaaggtagggtgttaaatatttacaagttttcttcgtcaattgagccaccataaaccacagattcttgaacc |
24400749 |
T |
 |
| Q |
129 |
ttttgatcatcaagaagtttcattaatctagttaagtgttgtttattaactatccttgctatagtgttggaatgttgtgggttgtctccaaacattttct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24400748 |
ttttgatcatcaagaagtttcattaatctagttaagtgttgtttattaactatccttgctatagtgttggaatgttgtgggttgtctccaaacattttct |
24400649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 228
Target Start/End: Complemental strand, 41844766 - 41844703
Alignment:
| Q |
165 |
tgttgtttattaactatccttgctatagtgttggaatgttgtgggttgtctccaaacattttct |
228 |
Q |
| |
|
|||||||||||||| |||||||| || || ||||| | || ||||||||||||||||||||||| |
|
|
| T |
41844766 |
tgttgtttattaacaatccttgcaatggtattggattcttttgggttgtctccaaacattttct |
41844703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University