View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19050_low_14 (Length: 460)
Name: NF19050_low_14
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19050_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 227 - 361
Target Start/End: Complemental strand, 16376723 - 16376589
Alignment:
| Q |
227 |
agcagaaacaaattttgcgccaaatcctcaaaactcgatcacaagtttaccaaacattgcaaatataatacgctagcttatcaacaatttgtactgagag |
326 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16376723 |
agcagaaacaaattttgcgccaaatcgtcaaaactccatcacaagtttaacaaacattgcaaatataatacgctagcttatcaacaatttgtactgagag |
16376624 |
T |
|
| Q |
327 |
cctaaacatttcttagctttatttaattgtgaggt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16376623 |
cctaaacatttcttagctttatttaattgtgaggt |
16376589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 32 - 152
Target Start/End: Complemental strand, 16376905 - 16376786
Alignment:
| Q |
32 |
caacatagcaaagagcgccgtatataattggaacacctaaaagaacacccatacaccccctacatcaaatacaaactctgacaaaacaaccaaagacact |
131 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16376905 |
caacatagcaaatagcgccgtatataatttgaacacctaaaa-aacacccatacaccccctacatcaaatacaaactctgacaaaacaaccaaagacact |
16376807 |
T |
|
| Q |
132 |
ccccaatgagagataccaccg |
152 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16376806 |
ccccaatgagagataccaccg |
16376786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University