View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19050_low_25 (Length: 354)

Name: NF19050_low_25
Description: NF19050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19050_low_25
NF19050_low_25
[»] chr1 (2 HSPs)
chr1 (270-345)||(4015811-4015886)
chr1 (273-335)||(4017639-4017701)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 270 - 345
Target Start/End: Complemental strand, 4015886 - 4015811
Alignment:
270 gatgatgactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgggatct 345  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
4015886 gatgaagactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgagatct 4015811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 335
Target Start/End: Complemental strand, 4017701 - 4017639
Alignment:
273 gatgactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttcc 335  Q
    ||||||||||||||| ||| ||||| |||| || |||||| | ||||||||||| ||||||||    
4017701 gatgactctgtcaccggcggtcctctccgaggatctcatcgtcgaggtactttcgtttcttcc 4017639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University